Save
Saving
  • OlgaM

    Hi,
    possibly a futile question, but is there a way to make figure captions NOT italic? There are no options whatsoever for caption text apart from the alignment. Also, the justified options makes the caption stretch in an unnatural way.
    cheers

    posted in General Discussion read more
  • OlgaM

    I have now! they asked me to send them my manuscript so they can check why upon export to PDF all my figures go blurry. Any luck @Adam-Buckley?

    posted in Comments & Feedback read more
  • OlgaM

    I haven't received a reply to my email to support@manuscriptsapp.com.

    posted in Comments & Feedback read more
  • OlgaM

    thanks for reply. I need to be able to copy and paste Greek letters, otherwise I'll go crazy, so I can't use insert->symbol becasue these symbols cannot be copied and pasted. The cmd+ctrl+space does not contain all greek letters, especially 'beta'. Any solution?
    And what about a general overall shortcut cheat sheet for Maunuscripts?

    posted in General Discussion read more
  • OlgaM

    Same thoughts here. Communication is key for better or for worse. I'd rather hear that fixes are delayed, rather than not hear at all. I have an extremely pressing issue of Manuscripts exporting blurry and squished images into PDF (while the text is fine) and I can't get any help from you. I do want to support you and I'm rooting for you because your software is unique and could become a major software used by scientists, but you have to keep us encouraged!

    posted in Comments & Feedback read more
  • OlgaM

    Hi,
    there isn't a day without Manuscript crashing, even multiple times a day. It crashes most notably while copying and pasting, while saving, while undoing and while deleting a corrupted paragraph (how do these corrupted paragraphs ever appear?).

    posted in General Discussion read more
  • OlgaM

    @juliakate

    I found out that these is whole separate menu of symbols (it's really the emoticon menu but with basic greek symbols in there too). If you go ctrl+cmd+space you get a pop up window. I choose the greek sign for 'mu' or 'micro' and then this sign can be copy and pasted like a normal letter.

    hope this helps!

    posted in General Discussion read more
  • OlgaM

    Hi @jonasludvigsson

    Yes, they are terrible replying to questions on the forum, and considering that it's such a new software with LOTS of unpolished features AND they are charging money for it, they should be on the ball.

    Anyway, to answer your questions (perhaps users could help users more!) the email address is: support@manuscriptsapp.com

    To get the journal templates, you have to get the little main screen that opens every time you open Manuscripts (it might open behind your document if you are opening a document, rather than just the app). You go: Create new manuscript -> Research article

    hope that helps!

    posted in General Discussion read more
  • OlgaM

    @rstankey there is a trick! It is true that generally you can't paste into tables, which is extremely annoying, but I discovered that Manuscripts works in a way that it assigns attributes to things (so it knows what they are by nature. Similar to when you want to paste a section heading into a paragraph it adds those funny numbers and stars to indicate that this bit of text used to be a heading before). Anyway, the trick is that you can paste from Excel to a table in Manuscripts! I guess it recognizes that it used to be in a table, so it's fine with copying it in a table. You can paste a whole table from Excel to Manuscripts, or you can paste your oligo sequences first into Excel and from there to Manuscripts. To be honest, I tend to make tables in Excel, save them as PDF and put into Manuscripts as a Figure. Hate tables in Manuscripts. Useless.

    hope it helps!

    posted in General Discussion read more
  • OlgaM

    Hi,

    I feel like I have no control over column widths in the table. If I have a very long word in the right column (like a primer sequence, something long without spaces), then if the name of it in the left column has spaces, then that name gets totally squished to the left and I end up having every word of that name in a separate line. Seems like I cannot control column width at all. Please help!

    Example:

    What I want:

    name of primer F CGTGACGTAGCTAGCTAACCGGTTGTGCGTTAGGCTTCGGAT
    name of primer R CGTGACGTAGCTAGCTAACCGGTTGTGCGTTAGGCTTCGGAT

    what I get:

    name
    of CGTGACGTAGCTAGCTAACCGGTTGTGCGTTAGGCTTCGGAT
    primer
    F

    name
    of CGTGACGTAGCTAGCTAACCGGTTGTGCGTTAGGCTTCGGAT
    primer
    R

    posted in General Discussion read more